greisen


Also found in: Thesaurus, Encyclopedia, Wikipedia.

grei·sen

 (grī′zən)
n.
A granitic rock composed chiefly of quartz and mica.
[German, from greissen, to split.]
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

greisen

(ˈɡraɪzən)
n
(Geological Science) a light-coloured metamorphic rock consisting mainly of quartz, white mica, and topaz formed by the pneumatolysis of granite
[C19: from German, from greissen to split]
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.greisen - a granitic rock composed of quartz and mica
rock, stone - material consisting of the aggregate of minerals like those making up the Earth's crust; "that mountain is solid rock"; "stone is abundant in New England and there are many quarries"
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
Mentioned in ?
References in periodicals archive ?
* Thomas, Head & Greisen announced the appointment of Shane A.
RIGHT MOVES
Auf seinem greisen Haupte schellt und klingt Ein Narrenhelm statt einem Konigsband.
Five Poems on Bucolic Themes
HellstrAaAaAeA m-Westas L, Rosen I, de Vries LS, Greisen G.
Clinical Manifestations and Amplitude-integrated Encephalogram in Neonates with Early-onset Epileptic Encephalopathy
(9.) Sweet DG, Carnielli V, Greisen G, Hallman M, Ozek E, Plavka R, et al.
The Change of Perinatal Mortality Over Three Decades in a Reference Centre in the Aegean Region: Neonatal Mortality has decreased but Foetal Mortality Remains Unchanged
Jakob Greisen, vice-president and head of the US motoring department at Bonhams, said the top end was performing well.
Supercars are there for the leasing
16StDNA gene of the extracted DNA was amplified using the primers 16S f5' AGGAGGTGATCCAACCGCA3' y 16S r 5 AACTGGAGGAAGGTGGGGAT3' (Greisen et al, 1994).
Anaerobic biodegradation of polyaromatic hydrocarbons by a sulfate reducing bacteria C1Fd strain
Greisen et al., "European consensus guidelines on the management of neonatal respiratory distress syndrome in preterm infants--2013 update," Neonatology, vol.
The Effect of the Treatment with Heated Humidified High-Flow Nasal Cannula on Neonatal Respiratory Distress Syndrome in China: A Single-Center Experience
A specialized topaz-bearing rapakivi granite and associated mineralized greisen in the Ahvenisto Complex, SE Finland.
Geochronology and lithogeochemistry of granitoid rocks from the central part of the Central plutonic belt, New Brunswick, Canada: implications for Sn-W-Mo exploration

Dictionary browser ?
Full browser ?